circad | circRNAs associated with diseases

hsa_circ_0004015
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Non-Small Cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink		PMID	30509491
Experimental Method
Sample Type	Tissue and cell lines	Comparison	35 pairs of NSCLC and corresponding normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGCCAACAAGTCCCAAATTTG Reverse TGTGTCCAGGGGTTTGATCA	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Zhou, Y, Zheng, X, Xu, B, Chen, L, Wang, Q, Deng, H, Jiang, J (2019). Circular RNA hsa_circ_0004015 regulates the proliferation, invasion, and TKI drug resistance of non-small cell lung cancer by miR-1183/PDPK1 signaling pathway. Biochem. Biophys. Res. Commun., 508, 2:527-535.